Stem-loop sequence ppt-MIR2081

AccessionMI0010535 (change log)
DescriptionPhyscomitrella patens miR2081 stem-loop
Stem-loop
   ----guuu   cagua   cagu                                  g    ag 
5'         gcc     cuc    gaucagacacauaacucuagcuauugggcagaca uguu  a
           |||     |||    |||||||||||||||||||||||||||||||||| ||||   
3'         ugg     gag    uuagucuguguauugagaucgauaacccgucugu acag  g
   aauuucug   ---ac   -aau                                  g    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 9091502-9091623 [-]
intergenic
Database links

Mature sequence ppt-miR2081

Accession MIMAT0010020
Sequence

82 - 

agcuagaguuaugugucugau

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1