Stem-loop sequence ppt-MIR2085

AccessionMI0010534 (change log)
DescriptionPhyscomitrella patens miR2085 stem-loop
Gene family MIPF0000809; MIR2084
Stem-loop
   --------aaa    -    g    u           uuc a               ucc 
5'            aucu gaaa ucgu gaagcgccugc   g uggauugugggcuac   u
              |||| |||| |||| |||||||||||   | |||||||||||||||   c
3'            uaga cuuu agca cuucgcggacg   c accuaacaccugaug   c
   gucaauguuca    a    a    c           uaa a               uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 9486736-9486849 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR2085
ppt-MIR2085Chr18: 9486736-9486849 [+]
ppt-MIR2084Chr18: 9486736-9486849 [-]
Database links

Mature sequence ppt-miR2085

Accession MIMAT0010019
Sequence

65 - 

acaauccaacaaugcaggcgc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1