Stem-loop sequence ppt-MIR2084

AccessionMI0010533 (change log)
DescriptionPhyscomitrella patens miR2084 stem-loop
Gene family MIPF0000809; MIR2084
Stem-loop
   caguuacaagu    u    u    g           a   u          a    aac 
5'            aucu gaaa ucgu gaagcgccugc uug uggauugugg cuac   g
              |||| |||| |||| ||||||||||| ||| |||||||||| ||||   g
3'            uaga cuuu agca cuucgcggacg agc accuaacacc gaug   a
   --------uuu    -    c    a           a   u          c    agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 9486736-9486849 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR2084
ppt-MIR2085Chr18: 9486736-9486849 [+]
ppt-MIR2084Chr18: 9486736-9486849 [-]
Database links

Mature sequence ppt-miR2084

Accession MIMAT0010018
Sequence

33 - 

ccugcauuguuggauugugga

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1