Stem-loop sequence ppt-MIR2080

AccessionMI0010532 (change log)
DescriptionPhyscomitrella patens miR2080 stem-loop
Stem-loop
   -------g         uguuaag g                                         uuu 
5'         cugcguguu       u agaaauuccauaucaauucgcagaugccgcuucagaacugg   u
           |||||||||       | |||||||||||||||||||||||||||||||||||||||||   a
3'         gaugugcag       g ucuuuaagguauaguuaagcgucuacggcgaagucuugacc   c
   cgauuugg         ------- g                                         uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr09: 2064958-2065086 [+]
intergenic
Database links

Mature sequence ppt-miR2080

Accession MIMAT0010017
Sequence

26 - 

uccauaucaauucgcagaugc

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1