Stem-loop sequence ppt-MIR2079

AccessionMI0010531 (change log)
DescriptionPhyscomitrella patens miR2079 stem-loop
Stem-loop
   auauaa     a  ua  ----                                         g 
5'       guacu au  au    uuaugcgucaucaacaucaacucuucauaguuauuauauaa u
         ||||| ||  ||    |||||||||||||||||||||||||||||||||||||||||  
3'       uauga ua  ua    aauacgcaguaguuguaguugagaaguaucaauaauauauu a
   ---uag     a  gc  caaa                                         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr07: 2829022-2829144 [+]
intergenic
Database links

Mature sequence ppt-miR2079

Accession MIMAT0010016
Sequence

81 - 

agaguugauguugaugacgca

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1