Stem-loop sequence ppt-MIR2078

AccessionMI0010530 (change log)
DescriptionPhyscomitrella patens miR2078 stem-loop
Stem-loop
   ggaggauuacugauauauucuagcacggcaagagagg    -a  c                              gggga   a  c      u 
5'                                      uggc  ag cucauguacaggcacaggcaagccaacccu     uca cu guucag u
                                        ||||  || ||||||||||||||||||||||||||||||     ||| || |||||| g
3'                                      gccg  uc gaguacauguccguguccguucgguuggga     agu ga cgaguc a
   ------------gcucagcuagggaucccaaauuaga    ag  a                              ----g   c  u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr27: 5212048-5212223 [+]
intergenic
Database links

Mature sequence ppt-miR2078

Accession MIMAT0010015
Sequence

115 - 

gguuggcuugccugugccugu

 - 135

Get sequence
Evidence experimental; Illumina [1]

References

1