Stem-loop sequence ppt-MIR2077

AccessionMI0010529 (change log)
DescriptionPhyscomitrella patens miR2077 stem-loop
Stem-loop
   uucgacgcugcuaucu              a                         a   u 
5'                 ugaauggaaauaug cguguuuaugagcuuaguggcuggu guu c
                   |||||||||||||| ||||||||||||||||||||||||| |||  
3'                 acuuaccuuuauac gcacaaauacucgaaucaccgacca caa c
   agucaacucuaguugg              c                         a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr13: 10758230-10758353 [+]
intergenic
Database links

Mature sequence ppt-miR2077

Accession MIMAT0010014
Sequence

83 - 

ucauaaacacgccauauuucc

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1