Stem-loop sequence bfl-mir-9-2

Accession MI0010521
Description Branchiostoma floridae miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--------------      c               g    a a u u 
              uguugu uuugguuaucuagcu uaug g g c u
              |||||| ||||||||||||||| |||| | | |  
              acaaca aaaccaauggaucga auac c c g u
gaucccccuuacca      -               a    - a u u 
Get sequence
Deep sequencing
225 reads, 1 experiments
Comments

The miR-9-3p sequence was previously named mir-79 here and in [1]. The two are clearly processed from the same hairpin, so entries are merged here.

Genome context
Coordinates (JGI2.0) Overlapping transcripts
Bf_V2_430: 38051-38132 [+]
intergenic

Mature sequence bfl-miR-9-5p

Accession MIMAT0009465
Previous IDs bfl-miR-9
Sequence

6 - 

ucuuugguuaucuagcuguaug

 - 27

Get sequence
Deep sequencing 450 reads, 1 experiments
Evidence experimental; 454 [1], cloned [2]

Mature sequence bfl-miR-9-3p

Accession MIMAT0009477
Previous IDs bfl-miR-79
Sequence

44 - 

auaaagcuagguaaccaaaaca

 - 65

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2