Stem-loop sequence bfl-mir-9-2

AccessionMI0010521 (change log)
DescriptionBranchiostoma floridae miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --------------      c               g    a a u u 
5'               uguugu uuugguuaucuagcu uaug g g c u
                 |||||| ||||||||||||||| |||| | | |  
3'               acaaca aaaccaauggaucga auac c c g u
   gaucccccuuacca      -               a    - a u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The miR-9-3p sequence was previously named mir-79 here and in [1]. The two are clearly processed from the same hairpin, so entries are merged here.

Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666846.1: 38051-38132 [+]
intergenic
Database links

Mature sequence bfl-miR-9-5p

Accession MIMAT0009465
Previous IDsbfl-miR-9
Sequence

6 - 

ucuuugguuaucuagcuguaug

 - 27

Get sequence
Evidence experimental; 454 [1], cloned [2]

Mature sequence bfl-miR-79

Accession MIMAT0009477
Sequence

44 - 

auaaagcuagguaaccaaaaca

 - 65

Get sequence
Evidence experimental;

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2