Stem-loop sequence bfl-mir-2062

AccessionMI0010497 (change log)
DescriptionBranchiostoma floridae miR-2062 stem-loop
Gene family MIPF0001753; mir-2062
Stem-loop
   -----------   g  c      a               ugaac 
5'            ccu cu ugcaac auauuucaucagugg     u
              ||| || |||||| |||||||||||||||     c
3'            gga ga gcguug uguaaaguggucauc     c
   ugucaccggcc   g  u      a               uaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666582.1: 2072211-2072292 [-]
intergenic
Database links

Mature sequence bfl-miR-2062-5p

Accession MIMAT0009988
Previous IDsbfl-miR-2062
Sequence

8 - 

ugcaacaauauuucaucagugg

 - 29

Get sequence
Evidence experimental; cloned [1], 454 [2]

Mature sequence bfl-miR-2062-3p

Accession MIMAT0019169
Previous IDsbfl-miR-2062*
Sequence

45 - 

acuggugaaauguaguugcgua

 - 66

Get sequence
Evidence experimental; 454 [2]

References

1
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).