Stem-loop sequence bfl-mir-2058

AccessionMI0010493 (change log)
DescriptionBranchiostoma floridae miR-2058 stem-loop
Gene family MIPF0001793; mir-2058
Stem-loop
   -------------  g   u             a        u   u 
5'              gc aag gagaaguaagacu ccaucccg gug g
                || ||| ||||||||||||| |||||||| ||| c
3'              cg uuc uucuucguucugg gguggggc cau u
   cacaacauuuggg  a   u             -        -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666509.1: 857171-857252 [+]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-2058
bfl-mir-2057GG666509.1: 856161-856242 [+]
bfl-mir-2058GG666509.1: 857171-857252 [+]
Database links

Mature sequence bfl-miR-2058-5p

Accession MIMAT0009984
Previous IDsbfl-miR-2058
Sequence

7 - 

ugagaaguaagacuaccaucccgu

 - 30

Get sequence
Evidence experimental; cloned [1], 454 [2]

Mature sequence bfl-miR-2058-3p

Accession MIMAT0019167
Previous IDsbfl-miR-2058*
Sequence

44 - 

ggguggggucuugcuucuuucu

 - 65

Get sequence
Evidence experimental; 454 [2]

References

1
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).