Stem-loop sequence osa-MIR827

AccessionMI0010490 (change log)
DescriptionOryza sativa miR827 stem-loop
Gene family MIPF0000726; MIR827
Literature search

24 open access papers mention osa-MIR827
(69 sentences)

Stem-loop
   -u       c               c     aug  u    -auug   aauaauuga    gc 
5'   uuuguug uggucaucuagcuac cgugc   cc ggag     gag         cgau  a
     ||||||| ||||||||||||||| |||||   || ||||     |||         ||||   
3'   aaacgac accaguagauuggug gcacg   gg ucuc     uuc         gcug  g
   ac       u               c     ---  u    gguua   --------g    ac 
Get sequence
Deep sequencing
727 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence osa-miR827

Accession MIMAT0009981
Sequence

97 - 

uuagaugaccaucagcaaaca

 - 117

Get sequence
Deep sequencing722 reads, 2 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links

References

1
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).