Stem-loop sequence osa-MIR2055

AccessionMI0010489 (change log)
DescriptionOryza sativa miR2055 stem-loop
Literature search

3 open access papers mention osa-MIR2055
(25 sentences)

Stem-loop
         u    g    ag          cacagacauugacacgcaauu 
5' agaaga ggag cacc  cccaaggaaa                     c
   |||||| |||| ||||  ||||||||||                     a
3' ucuucu cuuu gugg  ggguuccuuu                     a
         -    g    aa          uucauccugcguuagaagagg 
Get sequence
Deep sequencing
394 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 431432-431531 [-]
intergenic
Database links

Mature sequence osa-miR2055

Accession MIMAT0009980
Sequence

74 - 

uuuccuugggaaggugguuuc

 - 94

Get sequence
Deep sequencing289 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).