Stem-loop sequence bta-mir-181b-1

AccessionMI0010485 (change log)
DescriptionBos taurus miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

23 open access papers mention bta-mir-181b-1
(57 sentences)

Stem-loop
   cuugggcagagguucuuucuuaaaa       aucaa         cug          gaa  g 
5'                          ggucaca     cauucauug   ucgguggguu   cu u
                            |||||||     |||||||||   ||||||||||   ||  
3'                          ccggugu     gugaguaac   agucacucga   gg g
   -------------------uacgcc       -caac         --a          aca  u 
Get sequence
Deep sequencing
62177 reads, 478 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 79940310-79940419 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-181b-1
bta-mir-181a-1chr16: 79940482-79940591 [-]
bta-mir-181b-1chr16: 79940310-79940419 [-]
Database links

Mature sequence bta-miR-181b

Accession MIMAT0003793
Sequence

36 - 

aacauucauugcugucgguggguu

 - 59

Get sequence
Deep sequencing124458 reads, 78 experiments
Evidence experimental; cloned [1,3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).