Stem-loop sequence bta-mir-181a-1

AccessionMI0010484 (change log)
DescriptionBos taurus miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

33 open access papers mention bta-mir-181a-1
(238 sentences)

Stem-loop
   ---u   cucc a     -  uc  u a   u      cu       a    g  auu 
5'     gag    g gguug cu  ag g aca ucaacg  gucggug guuu ga   a
       |||    | ||||| ||  || | ||| ||||||  ||||||| |||| ||    
3'     cuc    c ccaac gg  uc c ugu aguugc  cagcuac caaa cu   a
   ccac   -uac a     c  ua  c a   u      --       -    a  aaa 
Get sequence
Deep sequencing
986793 reads, 1.04e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 79940482-79940591 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-181a-1
bta-mir-181a-1chr16: 79940482-79940591 [-]
bta-mir-181b-1chr16: 79940310-79940419 [-]
Database links

Mature sequence bta-miR-181a

Accession MIMAT0003543
Sequence

24 - 

aacauucaacgcugucggugaguu

 - 47

Get sequence
Deep sequencing1960794 reads, 78 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).