Stem-loop sequence bta-mir-1249

AccessionMI0010481 (change log)
DescriptionBos taurus miR-1249 stem-loop
Gene family MIPF0000667; mir-1249
Literature search

7 open access papers mention bta-mir-1249
(15 sentences)

Stem-loop
   ---g         a  a  u    cac     cuc 
5'     ggaggaggg gg ga gggc   guucc   u
       ||||||||| || || ||||   |||||    
3'     cuucuuccc cc cu cccg   caagg   g
   ucca         -  c  u    ---     ucc 
Get sequence
Deep sequencing
957 reads, 1.49 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 116683134-116683198 [-]
sense
ENSBTAT00000008911 ; KIAA0930-201; intron 6
Database links

Mature sequence bta-miR-1249

Accession MIMAT0009976
Sequence

41 - 

acgcccuucccccccuucuuca

 - 62

Get sequence
Deep sequencing904 reads, 67 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).