Stem-loop sequence bta-mir-1271

AccessionMI0010480 (change log)
DescriptionBos taurus miR-1271 stem-loop
Gene family MIPF0000483; mir-1271
Literature search

8 open access papers mention bta-mir-1271
(15 sentences)

Stem-loop
   -ca  -   au             c     a          ua 
5'    cc cag  cagugcuuggcac uagua guacucagua  u
      || |||  ||||||||||||| ||||| ||||||||||   
3'    gg guc  guuacggaccgug aucgu cgugaguugu  a
   ucg  a   gu             u     c          uc 
Get sequence
Deep sequencing
2020 reads, 0 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 39336532-39336617 [+]
sense
ENSBTAT00000035563 ; ARL10-201; intron 2
Database links

Mature sequence bta-miR-1271

Accession MIMAT0009975
Sequence

15 - 

cuuggcaccuaguaaguacuca

 - 36

Get sequence
Deep sequencing1883 reads, 68 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).