Stem-loop sequence bta-mir-1248-1

AccessionMI0010477 (change log)
DescriptionBos taurus miR-1248-1 stem-loop
Gene family MIPF0000622; mir-1248
Literature search

1 open access papers mention bta-mir-1248-1
(1 sentences)

Stem-loop
   --------uuuac        a   gc   g     ---aa               a 
5'              cuucuugu uaa  acu ugcua     auuacagaaaccaag u
                |||||||| |||  ||| |||||     ||||||||||||||| a
3'              gaagaaca auu  uga acgau     uaauguuuuugguuc g
   acgucaaggagaa        c   -a   g     cguaa               c 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 81349834-81349938 [-]
sense
ENSBTAT00000062221 ; SNORA81-201; exon 1
ENSBTAT00000019596 ; EIF4A2-201; intron 7
Database links

Mature sequence bta-miR-1248

Accession MIMAT0009972
Sequence

4 - 

accuucuuguauaagcacugugcuaaa

 - 30

Get sequence
Deep sequencing28 reads, 10 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).