Stem-loop sequence bta-mir-1287

AccessionMI0010476 (change log)
DescriptionBos taurus miR-1287 stem-loop
Gene family MIPF0000725; mir-1287
Stem-loop
   --------     ----   --u   cagg       uca       ---   uc 
5'         gcucu    gcu   ucc    ugcugga   gugguuu   gag  u
           |||||    |||   |||    |||||||   |||||||   |||  g
3'         cgagg    uga   agg    acgaucu   caccgaa   cuc  a
   aacaguau     uuag   cgc   --ca       ---       aau   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 19457906-19457996 [-]
sense
ENSBTAT00000032952 ; PYROXD2-201; exon 8
Database links

Mature sequence bta-miR-1287

Accession MIMAT0009971
Sequence

17 - 

ugcuggaucagugguuugaguc

 - 38

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).