Stem-loop sequence bta-mir-1298

AccessionMI0010475 (change log)
DescriptionBos taurus miR-1298 stem-loop
Gene family MIPF0000598; mir-1298
Stem-loop
   --aga        u         u    c             ------       cc 
5'      ugagaagu aagaguuca ucgg uguccagauguau      ccaagua  c
        |||||||| ||||||||| |||| |||||||||||||      |||||||   
3'      gcuuuucg uuuucaagu aguc acgggucuacaua      gguuuau  u
   cucag        u         u    a             aauaac       ag 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 68750834-68750941 [+]
intergenic
Database links

Mature sequence bta-miR-1298

Accession MIMAT0009970
Sequence

18 - 

uucauucggcuguccagaugua

 - 39

Get sequence
Deep sequencing28 reads, 13 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).