Stem-loop sequence bta-mir-1307

AccessionMI0010474 (change log)
DescriptionBos taurus miR-1307 stem-loop
Gene family MIPF0000558; mir-1307
Literature search

2 open access papers mention bta-mir-1307
(3 sentences)

Stem-loop
   --     a   u    ---    ---  -a   --cc        c a   u       -a  u  a   gc   ucuaua 
5'   cauca gag cggc   ugag   uc  cug    acugccua c auc cgaccgg  cc cg ccg  ucg      u
     ||||| ||| ||||   ||||   ||  |||    |||||||| | ||| |||||||  || || |||  |||       
3'   guggu cuc guug   acuu   ag  gac    uggcggau g ugg gcuggcu  gg gc ggc  agc      u
   ca     -   -    uga    uug  ca   auac        a a   u       gc  u  -   uc   uaaccg 
Get sequence
Deep sequencing
52264 reads, 494 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 24356476-24356624 [-]
sense
ENSBTAT00000012810 ; USMG5-201; intron 1
Database links

Mature sequence bta-miR-1307

Accession MIMAT0009969
Sequence

80 - 

acucggcguggcgucggucgug

 - 101

Get sequence
Deep sequencing11995 reads, 73 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).