Stem-loop sequence bta-mir-1839

AccessionMI0010473 (change log)
DescriptionBos taurus miR-1839 stem-loop
Gene family MIPF0000702; mir-1839
Literature search

3 open access papers mention bta-mir-1839
(6 sentences)

Stem-loop
   --aaugaaaa        gaac     u  uuug a 
5'           gguagaua    agguc ug    c a
             ||||||||    ||||| ||    | a
3'           ccaucuau    uccag ac    g a
   guaacgacaa        -aca     u  uuaa u 
Get sequence
Deep sequencing
12428 reads, 63.2 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 1928039-1928110 [-]
sense
ENSBTAT00000037418 ; MROH1-201; intron 1
ENSBTAT00000061839 ; SCARNA15-201; exon 1
Database links

Mature sequence bta-miR-1839

Accession MIMAT0009968
Sequence

7 - 

aagguagauagaacaggucuuguu

 - 30

Get sequence
Deep sequencing12419 reads, 76 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).