Stem-loop sequence bta-mir-1197

AccessionMI0010470 (change log)
DescriptionBos taurus miR-1197 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   -----cuucc       -u     cgc   u       gug g    - uuu 
5'           ugguauu  gaaga   ggu gaccaug   u uacg c   a
             |||||||  |||||   ||| |||||||   | |||| |   u
3'           acuauag  cuucu   uca cugguac   g augc g   u
   ccgcuucuac       cu     ---   u       aca g    a uau 
Get sequence
Deep sequencing
178 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67843672-67843768 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-1197
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
Database links

Mature sequence bta-miR-1197

Accession MIMAT0009966
Sequence

56 - 

uaggacacauggucuacuucu

 - 76

Get sequence
Deep sequencing170 reads, 51 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).