Stem-loop sequence bta-mir-1193

AccessionMI0010469 (change log)
DescriptionBos taurus miR-1193 stem-loop
Gene family MIPF0000714; mir-1193
Stem-loop
   ccagccgcucucca    a    a g       -    c      g    cu  au 
5'               gggu gcug g ggauggu aggc ggugac ugca  uc  u
                 |||| |||| | ||||||| |||| |||||| ||||  ||   
3'               ccca cgac c ccuauca uuug ccacug augu  ag  u
   ----gucuaccuga    -    - a       g    c      g    --  ca 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67848381-67848485 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-1193
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
bta-mir-376echr21: 67856314-67856395 [+]
bta-mir-376cchr21: 67856685-67856770 [+]
bta-mir-376dchr21: 67857059-67857140 [+]
bta-mir-654chr21: 67857212-67857292 [+]
bta-mir-376bchr21: 67857435-67857527 [+]
bta-mir-376achr21: 67857794-67857892 [+]
Database links

Mature sequence bta-miR-1193

Accession MIMAT0009965
Sequence

64 - 

uaggucacccguuugacuauc

 - 84

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).