Stem-loop sequence bta-mir-1296

AccessionMI0010468 (change log)
DescriptionBos taurus miR-1296 stem-loop
Gene family MIPF0000649; mir-1296
Literature search

2 open access papers mention bta-mir-1296
(5 sentences)

Stem-loop
   ccua    a           c cu        cu   u     a 
5'     ccua cuggguuaggg c  ggcuccau  ccu uagga a
       |||| ||||||||||| |  ||||||||  ||| ||||| a
3'     gggu gauccaauccc g  ucggggug  ggg gucuu c
   uguc    c           a uu        ag   u     c 
Get sequence
Deep sequencing
1099 reads, 1.56 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 19648967-19649057 [-]
sense
ENSBTAT00000002067 ; JMJD1C-201; intron 2
Database links

Mature sequence bta-miR-1296

Accession MIMAT0009964
Sequence

15 - 

uuagggcccuggcuccaucucc

 - 36

Get sequence
Deep sequencing1072 reads, 64 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).