Stem-loop sequence bta-mir-1251

AccessionMI0010467 (change log)
DescriptionBos taurus miR-1251 stem-loop
Gene family MIPF0000621; mir-1251
Stem-loop
   -----  gg  u  a    cca         --c  c 
5'      gu  ac cu gcug   aaggcgcuu   uc u
        ||  || || ||||   |||||||||   || u
3'      ca  ug ga cgac   uuucgcgag   ag c
   cggua  ga  u  c    ucg         cca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 62234415-62234484 [+]
intergenic
Database links

Mature sequence bta-miR-1251

Accession MIMAT0009963
Sequence

5 - 

acucuagcugccaaaggcgcu

 - 25

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).