Stem-loop sequence bta-mir-1835

AccessionMI0010465 (change log)
DescriptionBos taurus miR-1835 stem-loop
Stem-loop
   --u   c  --------u    g ug     g  c 
5'    gca cc         gaga c  gggcu gu u
      ||| ||         |||| |  ||||| || c
3'    cgu gg         cucu g  uccgg ua c
   ggc   c  ugucuaaau    g gu     g  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 76263665-76263727 [-]
sense
ENSBTAT00000014666 ; RAC2-201; intron 1
Database links

Mature sequence bta-miR-1835

Accession MIMAT0009961
Sequence

1 - 

ugcacccugagagcuggggcug

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).