Stem-loop sequence bta-mir-1256

AccessionMI0010463 (change log)
DescriptionBos taurus miR-1256 stem-loop
Gene family MIPF0000594; mir-1256
Stem-loop
   ---------a   a     --u       -ag  ---uu          
5'           guc gccug   gcuuuga   cu     gaagucagg 
             ||| |||||   |||||||   ||     |||||||| c
3'           cag uggau   ugaaauu   ga     cuucaguua 
   uagauggaua   a     ucc       aua  ucucu          
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 57668832-57668913 [-]
intergenic
Database links

Mature sequence bta-miR-1256

Accession MIMAT0009960
Sequence

31 - 

aggcauugacuucucucuagau

 - 52

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).