Stem-loop sequence bta-mir-1301

AccessionMI0010460 (change log)
DescriptionBos taurus miR-1301 stem-loop
Gene family MIPF0000742; mir-1301
Stem-loop
   --  gu    g gg       -     -c c      -  g 
5'   gg  ugug g  gucacuc uaggc  c gcagca cu u
     ||  |||| |  ||||||| |||||  | |||||| || g
3'   cc  acac c  uagugag auccg  g cguugu gg c
   cu  ug    a uu       g     uc a      a  u 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 74189210-74189289 [+]
intergenic
Database links

Mature sequence bta-miR-1301

Accession MIMAT0009958
Sequence

46 - 

uugcagcugccuaggagugauuuc

 - 69

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).