Stem-loop sequence bta-mir-1179

AccessionMI0010459 (change log)
DescriptionBos taurus miR-1179 stem-loop
Gene family MIPF0000632; mir-1179
Literature search

1 open access papers mention bta-mir-1179
(1 sentences)

Stem-loop
   ---  c      -   a   --         c        gu uaug 
5'    gg cagaag gga gaa  gcauucuuu auugguug  g    u
      || |||||| ||| |||  ||||||||| ||||||||  |     
3'    uc gucuuu ccu uuu  cguaggaga uaaccaac  u    u
   cga  a      u   a   ac         c        ug uccg 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 20044885-20044974 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-1179
bta-mir-1179chr21: 20044885-20044974 [+]
bta-mir-7-1chr21: 20048987-20049084 [+]
Database links

Mature sequence bta-miR-1179

Accession MIMAT0009957
Sequence

15 - 

aagcauucuuucauugguugg

 - 35

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).