Stem-loop sequence bta-mir-1291

AccessionMI0010458 (change log)
DescriptionBos taurus miR-1291 stem-loop
Gene family MIPF0000599; mir-1291
Literature search

1 open access papers mention bta-mir-1291
(2 sentences)

Stem-loop
   -----------------u    -   ac   a    u       c 
5'                   ggcc cug  uga gacc gcaguua a
                     |||| |||  ||| |||| ||||||| c
3'                   ccgg gac  acu uugg cgucgau u
   guccuucugucacgagac    a   aa   -    u       a 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 31345647-31345720 [+]
sense
ENSBTAT00000059528 ; SNORA2-201; exon 1
ENSBTAT00000053829 ; KANSL2-202; intron 9
Database links

Mature sequence bta-miR-1291

Accession MIMAT0009956
Sequence

1 - 

uggcccugacugaagaccugcagu

 - 24

Get sequence
Deep sequencing87 reads, 47 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).