Stem-loop sequence bta-mir-1284

AccessionMI0010456 (change log)
DescriptionBos taurus miR-1284 stem-loop
Gene family MIPF0000604; mir-1284
Stem-loop
   --a   ug    ---         uuuaau    ucugc      c u  c     uuaaauu 
5'    uuu  auau   auaaaccag      guuu     acagac c gg uuuuc       u
      |||  ||||   |||||||||      ||||     |||||| | || |||||        
3'    aaa  uaua   uguuugguc      cagg     uguuug g cc aaagg       u
   cua   gu    cuu         ---uuc    --uua      u c  c     uuauaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 30351546-30351663 [+]
intergenic
Database links

Mature sequence bta-miR-1284

Accession MIMAT0009955
Sequence

30 - 

ucugcacagacccuggcuuuuc

 - 51

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).