Stem-loop sequence bta-mir-1282

AccessionMI0010455 (change log)
DescriptionBos taurus miR-1282 stem-loop
Gene family MIPF0000587; mir-1282
Stem-loop
   ccuucu   cg          uc       ----   g   g     cgag   c 
5'       ucu  uuugccuuuu  ugcuucu    gcu cau aucuc    ucc u
         |||  ||||||||||  |||||||    ||| ||| |||||    |||  
3'       agg  aaacgggaga  auggagg    cgg gua uagag    ggg a
   -----c   aa          cc       guca   g   g     --au   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 56214395-56214495 [-]
antisense
ENSBTAT00000063708 ; 3'UTR (exon 3)
Database links

Mature sequence bta-miR-1282

Accession MIMAT0009954
Sequence

9 - 

ucguuugccuuuuucugcuu

 - 28

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).