Stem-loop sequence bta-mir-1225

AccessionMI0010452 (change log)
DescriptionBos taurus miR-1225 stem-loop
Gene family MIPF0000445; mir-1225
Stem-loop
   g    ua    c      gggagagggacgcacccugggcccagc 
5'  uggg  cggc cagggg                           a
    ||||  |||| ||||||                           g
3'  accc  gccg gucccc                           a
   g    cc    u      gagccagucaggccgacgcgggacccg 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 1638363-1638455 [-]
sense
ENSBTAT00000027480 ; PKD1-201; intron 45
Database links

Mature sequence bta-miR-1225-3p

Accession MIMAT0009952
Sequence

71 - 

ccgagccccugugccgcccccag

 - 93

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).