Stem-loop sequence bta-mir-376d

AccessionMI0010445 (change log)
DescriptionBos taurus miR-376d stem-loop
Gene family MIPF0000091; mir-368
Literature search

1 open access papers mention bta-mir-376d
(1 sentences)

Stem-loop
   --     uu    g  a         u         cgg   u 
5'   gguau  aaaa gu gauuuuccu cuaugauua   guu g
     |||||  |||| || ||||||||| |||||||||   |||  
3'   cuaug  uuuu ca cuaaaagga gauacuaau   uag g
   aa     gc    a  c         -         ---   u 
Get sequence
Deep sequencing
2699 reads, 1.54 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67857059-67857140 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-376d
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
bta-mir-376echr21: 67856314-67856395 [+]
bta-mir-376cchr21: 67856685-67856770 [+]
bta-mir-376dchr21: 67857059-67857140 [+]
bta-mir-654chr21: 67857212-67857292 [+]
bta-mir-376bchr21: 67857435-67857527 [+]
bta-mir-376achr21: 67857794-67857892 [+]
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
Database links

Mature sequence bta-miR-376d

Accession MIMAT0010199
Sequence

50 - 

aucauagaggaaaauccacau

 - 70

Get sequence
Deep sequencing1243 reads, 65 experiments
Evidence by similarity; MI0003529
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).