Stem-loop sequence bta-mir-376b

AccessionMI0010444 (change log)
DescriptionBos taurus miR-376b stem-loop
Gene family MIPF0000091; mir-368
Literature search

1 open access papers mention bta-mir-376b
(1 sentences)

Stem-loop
   -uuc         u    g      a     u     u   - guga 
5'     uuugguauu aaaa guggau uuccu cuaug uua c    u
       ||||||||| |||| |||||| ||||| ||||| ||| |     
3'     aaacuauga uuuu uaccua aagga gauac aau g    u
   ucgu         c    g      a     -     u   a auac 
Get sequence
Deep sequencing
847 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67857435-67857527 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-376b
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-154cchr21: 67853625-67853699 [+]
bta-mir-376echr21: 67856314-67856395 [+]
bta-mir-376cchr21: 67856685-67856770 [+]
bta-mir-376dchr21: 67857059-67857140 [+]
bta-mir-654chr21: 67857212-67857292 [+]
bta-mir-376bchr21: 67857435-67857527 [+]
bta-mir-376achr21: 67857794-67857892 [+]
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
Database links

Mature sequence bta-miR-376b

Accession MIMAT0009945
Sequence

56 - 

aucauagaggaaaauccauguu

 - 77

Get sequence
Deep sequencing790 reads, 65 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).