Stem-loop sequence bta-mir-489

AccessionMI0010441 (change log)
DescriptionBos taurus miR-489 stem-loop
Gene family MIPF0000111; mir-489
Literature search

3 open access papers mention bta-mir-489
(5 sentences)

Stem-loop
   gu     c     g            gc c   cua       
5'   ggcag uuggu gucguaugugug  g cau   cuggaa 
     ||||| ||||| ||||||||||||  | |||   ||||| c
3'   ucguc aauca cgguauauacac  c gug   gauuug 
   --     a     g            ua a   -ag       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 10718640-10718721 [-]
sense
ENSBTAT00000023201 ; CALCR-201; intron 3
Clustered miRNAs
< 10kb from bta-mir-489
bta-mir-489chr4: 10718640-10718721 [-]
bta-mir-653chr4: 10717971-10718060 [-]
Database links

Mature sequence bta-miR-489

Accession MIMAT0009942
Sequence

52 - 

gugacaucacauauauggcgac

 - 73

Get sequence
Evidence by similarity; MI0003124
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).