Stem-loop sequence cfa-mir-671

AccessionMI0010425 (change log)
DescriptionCanis familiaris miR-671 stem-loop
Gene family MIPF0000358; mir-671
Stem-loop
   cagg      a   a      ga           -u   g 
5'     aagagg gga gcccug  ggggcuggagg  gau g
       |||||| ||| ||||||  |||||||||||  |||  
3'     uucucc ccu cgggac  ucuuggccucc  uug a
   ----      a   -      --           uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr16: 15278782-15278855 [+]
sense
ENSCAFT00000039993 ; cfa-mir-671-201; exon 1
ENSCAFT00000007821 ; cfa-mir-671-201; 3'UTR (exon 4)
antisense
ENSCAFT00000007725 ; GBX1-202; intron 1
Database links

Mature sequence cfa-miR-671

Accession MIMAT0009926
Sequence

50 - 

uccgguucucagggcuccacc

 - 70

Get sequence
Evidence by similarity; MI0006156
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).