Stem-loop sequence cfa-mir-452

AccessionMI0010399 (change log)
DescriptionCanis familiaris miR-452 stem-loop
Gene family MIPF0000287; mir-452
Stem-loop
     u          aac g        g  a       cuu   a 
5' gc aagcacuuac   u uuugcaga ga acugaga   ugu a
   || ||||||||||   | |||||||| || |||||||   |||  
3' cg uucgugaaug   a aaacgucu cu ugacucu   aca c
     u          --a g        a  c       ---   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 119926379-119926463 [-]
sense
ENSCAFT00000030414 ; GABRE-201; intron 6
Clustered miRNAs
< 10kb from cfa-mir-452
cfa-mir-452chrX: 119926379-119926463 [-]
cfa-mir-224chrX: 119925345-119925413 [-]
Database links

Mature sequence cfa-miR-452

Accession MIMAT0009900
Sequence

14 - 

aacuguuugcagaggaaacuga

 - 35

Get sequence
Evidence by similarity; MI0001733
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).