Stem-loop sequence cfa-mir-147

AccessionMI0010371 (change log)
DescriptionCanis familiaris miR-147 stem-loop
Gene family MIPF0000105; mir-147
Stem-loop
   a     u    c   ug   a    g       aacuagauua     
5'  cucua gaau uag  gaa cauu cugcaca          ugga 
    ||||| |||| |||  ||| |||| |||||||          ||| u
3'  gggau uuua auc  cuu guaa ggcgugu          acca 
   c     u    c   gu   c    a       ---------g     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr30: 11800621-11800706 [+]
sense
ENSCAFT00000049873 ; cfa-mir-147-201; exon 5
Database links

Mature sequence cfa-miR-147

Accession MIMAT0009874
Sequence

53 - 

gugugcggaaaugcuucugcua

 - 74

Get sequence
Evidence by similarity; MI0005544
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).