Stem-loop sequence cfa-mir-451

AccessionMI0010367 (change log)
DescriptionCanis familiaris miR-451 stem-loop
Gene family MIPF0000148; mir-451
Stem-loop
   u    g        ga                 a 
5'  uggg auggcgag  aaccguuaccauuacug g
    |||| ||||||||  |||||||||||||||||  
3'  accc ugucguuc  uugguaaugguaaugau u
   -    a        uc                 u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 43030863-43030931 [-]
sense
ENSCAFT00000043143 ; TLCD1-201; intron 1
antisense
ENSCAFT00000029869 ; cfa-mir-451-201; exon 10
Clustered miRNAs
< 10kb from cfa-mir-451
cfa-mir-144chr9: 43031035-43031094 [-]
cfa-mir-451chr9: 43030863-43030931 [-]
Database links

Mature sequence cfa-miR-451

Accession MIMAT0009870
Sequence

16 - 

aaaccguuaccauuacugaguu

 - 37

Get sequence
Evidence by similarity; MI0001731
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).