Stem-loop sequence cfa-mir-196a-1

AccessionMI0010360 (change log)
DescriptionCanis familiaris miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   -------      ga    a ua   a    c         - gc u  a 
5'        acugcu  guga u  ggu guuu auguuguug g  c gg u
          ||||||  |||| |  ||| |||| ||||||||| |  | ||  
3'        ugacgg  cacu a  cca caaa uacaacaac c  g uc u
   ucgucau      --    c gc   c    u         a aa -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 24895666-24895756 [-]
intergenic
Database links

Mature sequence cfa-miR-196a

Accession MIMAT0006662
Sequence

15 - 

uagguaguuucauguuguuggg

 - 36

Get sequence
Evidence by similarity; MI0000552
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).