Stem-loop sequence cfa-mir-33b

AccessionMI0010358 (change log)
DescriptionCanis familiaris miR-33b stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   ---  ---    -   c   c  -          uu         g  ag 
5'    gc   gggc ggc ccg gg ugcauugcug  gcauugcac ug  u
      ||   |||| ||| ||| || ||||||||||  ||||||||| ||  g
3'    cg   cccg ccg ggc cc acgugacggc  cgugacgug gc  a
   cca  guc    g   a   -  g          uc         g  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr5: 41685165-41685258 [+]
sense
ENSCAFT00000043059 ; SREBF1-201; intron 17
ENSCAFT00000029276 ; SREBF1-202; intron 17
Database links

Mature sequence cfa-miR-33b

Accession MIMAT0009862
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Evidence by similarity; MI0003646
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).