Stem-loop sequence cfa-mir-96

AccessionMI0010356 (change log)
DescriptionCanis familiaris miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   -      gg  g  u        a      uu      ---   uc 
5'  cugcuu  cc au uuggcacu gcacau  uugcuu   gug  u
    ||||||  || || |||||||| ||||||  ||||||   |||   
3'  ggcgaa  gg ua aaccguga cgugua  aacgag   cgc  c
   g      aa  g  u        -      cu      ucu   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr14: 7068754-7068842 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-96
cfa-mir-183chr14: 7068542-7068603 [+]
cfa-mir-96chr14: 7068754-7068842 [+]
cfa-mir-182chr14: 7072705-7072796 [+]
Database links

Mature sequence cfa-miR-96

Accession MIMAT0009861
Sequence

14 - 

uuuggcacuagcacauuuuugcu

 - 36

Get sequence
Evidence by similarity; MI0000881
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).