Stem-loop sequence cfa-mir-302d

AccessionMI0010353 (change log)
DescriptionCanis familiaris miR-302d stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
   --  u u   uu                cugugac 
5'   cc c acu  aacauggaggcacuug       a
     || | |||  ||||||||||||||||       u
3'   gg g uga  uuguaccuucgugaau       g
   gu  u -   uu                aaaaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr32: 32429032-32429101 [-]
antisense
ENSCAFT00000018607 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from cfa-mir-302d
cfa-mir-302bchr32: 32429500-32429574 [-]
cfa-mir-302cchr32: 32429366-32429433 [-]
cfa-mir-302achr32: 32429209-32429277 [-]
cfa-mir-302dchr32: 32429032-32429101 [-]
cfa-mir-367chr32: 32428905-32428972 [-]
Database links

Mature sequence cfa-miR-302d

Accession MIMAT0009858
Sequence

6 - 

acuuuaacauggaggcacuugc

 - 27

Get sequence
Evidence by similarity; MI0000774
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).