Stem-loop sequence cfa-mir-210

AccessionMI0010341 (change log)
DescriptionCanis familiaris miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   --------cc      c    gg     a   - c  u      c  c -     
5'           uccagg gcag  cagcc cug c ca cgcaca ug g cugc 
             |||||| ||||  ||||| ||| | || |||||| || | ||| u
3'           gggucc uguc  gucgg gac g gu gcgugu ac c ggcc 
   ccagcgcgac      c    ua     c   a u  -      c  c a     
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr18: 25675449-25675546 [-]
antisense
ENSCAFT00000048339 ; RASSF7-202; intron 4
Database links

Mature sequence cfa-miR-210

Accession MIMAT0009846
Sequence

54 - 

acugugcgugugacagcggcuga

 - 76

Get sequence
Evidence by similarity; MI0005039
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).