Stem-loop sequence cfa-mir-210

AccessionMI0010341 (change log)
DescriptionCanis familiaris miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --------cc      c    gg     a   - c  u      c  c -     
5'           uccagg gcag  cagcc cug c ca cgcaca ug g cugc 
             |||||| ||||  ||||| ||| | || |||||| || | ||| u
3'           gggucc uguc  gucgg gac g gu gcgugu ac c ggcc 
   ccagcgcgac      c    ua     c   a u  -      c  c a     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr18: 25675449-25675546 [-]
antisense
ENSCAFT00000048339 ; RASSF7-202; intron 4
Database links

Mature sequence cfa-miR-210

Accession MIMAT0009846
Sequence

54 - 

acugugcgugugacagcggcuga

 - 76

Get sequence
Evidence by similarity; MI0005039
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).