Stem-loop sequence cfa-mir-205

AccessionMI0010340 (change log)
DescriptionCanis familiaris miR-205 stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
         uc           c        ucucg 
5' cucuug  cuucauuccac ggagucug     u
   ||||||  ||||||||||| ||||||||     a
3' gaggac  gaagugaggug cuuuagac     c
         uu           a        caacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr7: 8090511-8090579 [+]
intergenic
Database links

Mature sequence cfa-miR-205

Accession MIMAT0009845
Sequence

7 - 

uccuucauuccaccggagucug

 - 28

Get sequence
Evidence by similarity; MI0004759
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).