Stem-loop sequence cfa-mir-184

AccessionMI0010337 (change log)
DescriptionCanis familiaris miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   -----c         c      ag     -    ug 
5'       cccuuauca uuuucc  ccagc uuug  a
         ||||||||| ||||||  ||||| ||||   
3'       gggaauagu aagagg  gguug gaau  c
   guggau         c      ca     u    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr3: 57914444-57914511 [-]
intergenic
Database links

Mature sequence cfa-miR-184

Accession MIMAT0009842
Sequence

42 - 

uggacggagaacugauaagggu

 - 63

Get sequence
Evidence by similarity; MI0000226
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).