Stem-loop sequence cfa-mir-135b

AccessionMI0010334 (change log)
DescriptionCanis familiaris miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
        --                   cau          uugcug 
5' gcucu  gcuguggccuauggcuuuu   uccuauguga      u
   |||||  |||||||||||||||||||   ||||||||||       
3' cgggg  ugacaucggguaccgaaaa   gggauguacu      u
        ag                   -uc          uaaucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr38: 1926558-1926646 [-]
intergenic
Database links

Mature sequence cfa-miR-135b

Accession MIMAT0009839
Sequence

15 - 

uauggcuuuucauuccuauguga

 - 37

Get sequence
Evidence by similarity; MI0000645
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).