Stem-loop sequence cfa-mir-34b

Accession MI0010332
Description Canis familiaris miR-34b stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     cg    -gua       uaa    c       ccu u 
gugcu  guuu    ggcagug   uuag ugauugu   c g
|||||  ||||    |||||||   |||| |||||||   |  
cacgg  caaa    ccgucac   aauc acuaaca   g c
     aa    acua       cuc    -       uuc u 
Get sequence
Genome context
Coordinates (CanFam2) Overlapping transcripts
chr5: 24567569-24567652 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-34b
cfa-mir-34b chr5: 24567569-24567652 [-]
cfa-mir-34c chr5: 24566990-24567044 [-]

Mature sequence cfa-miR-34b

Accession MIMAT0009838
Sequence

14 - 

aggcaguguaauuagcugauug

 - 35

Get sequence
Evidence by similarity; MI0004763
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).