Stem-loop sequence cfa-mir-34b

AccessionMI0010332 (change log)
DescriptionCanis familiaris miR-34b stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
        cg    -gua       uaa    c       ccu u 
5' gugcu  guuu    ggcagug   uuag ugauugu   c g
   |||||  ||||    |||||||   |||| |||||||   |  
3' cacgg  caaa    ccgucac   aauc acuaaca   g c
        aa    acua       cuc    -       uuc u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr5: 21558685-21558768 [-]
sense
ENSCAFT00000022554 ; C11orf88-201; intron 1
Clustered miRNAs
< 10kb from cfa-mir-34b
cfa-mir-34bchr5: 21558685-21558768 [-]
cfa-mir-34cchr5: 21558106-21558160 [-]
Database links

Mature sequence cfa-miR-34b

Accession MIMAT0009838
Sequence

14 - 

aggcaguguaauuagcugauug

 - 35

Get sequence
Evidence by similarity; MI0004763
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).