Stem-loop sequence cfa-mir-7-3

AccessionMI0010330 (change log)
DescriptionCanis familiaris miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   gagugguuguggucuagu      u     a  a       u      c  au 
5'                   gcugug ggaag cu gugauuu guuguu ug  g
                     |||||| ||||| || ||||||| |||||| ||   
3'                   cgauac ccuuc ga cacugaa caacag au  u
   -----------------g      u     -  -       -      u  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr20: 54993200-54993287 [-]
sense
Database links

Mature sequence cfa-miR-7

Accession MIMAT0006634
Sequence

25 - 

uggaagacuagugauuuuguugu

 - 47

Get sequence
Evidence by similarity; MI0000265
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).